project.GIM

Short sample of a DNA-substring of the HIV-Virus and the graphical representation of its structure:

gatgatcattatcgttatagcaatcatcct gatcattttt atgctcagtcgccgcaccaa
taccatagcccaggcgccgg tgaagatgatctaccccgac gtagatcgcagggcacctcc
tagcggcggagccccaacac gggaggaaatcaaaaacatc ctgctgggaatgcaccagct
acaacaagaggagaggcaga aggcggatgatttgaaaaaa agtacaccctcggtgtttca
gcgtaccgcaaacggccttc gtcagcgtctgagaggatat aaacctctga ctcaatcgct  

  
First: the music generation is either based on fractals, DNA-sequences or other maps and images.

Second: the initial values (notes, note values, rhythm) for the  voices are on the related  sequences. To get composition material, these codes were inverted, mirrored and so on.  Useful assistance for generating musical phrases from the original databases is given by several Musical Generator programs. 

Three: and last, but not least: without my head, my heart, my guitar and my musical sense (i.e. increasing velocity and tempo of voices, structuring the distribution of note material between the instruments), the compositions would have never been brought to a satisfactory end.

Combining these methods results in  a completely new kind of music which is collected within the GIM Project.

 

Enjoy! 

 

 

Jovan Pesec

Vienna, 21.05.2004 



z.a.r.k.o.s..cry
    music.from.outer.space

a.b.a.l.a.d.o.r.a
    concerto.4.guitar.&.string.quartet

e.n.i.g.m.a
    morph.4.harp.exponent.7.on.enigma

chrysanthemes
    12.morphs.on.chrysanthemes.linear.scan
    12.morphs.on.chrysanthemes.banded.scan

g.i.l.m.a.r.a.n.u.a
    introduction.12.morphs.&.finale.on.una.lagrima.4.guitar.solo
    homage.a.francisco.tárrega

v.i.r.u.s
    s(e)x dna.based.sequences.4.guitar.solo

variations.on.the.hiv.virus
    genetic.dances.based.on.the.sarkoma.associated.human.herpes.virus

ginger.bread.man
    fractal.sonata.4.guitar.solo

 


4further information vision4media.v4m.net


contact Jovan Pesec

 



a service of

updated: 21. Mai 2004
designed by Judith.P.Fischer