news.2001
 

14.November 2001: a.b.a.l.a.d.o.r.a  finished
13.September 2001: e.ni.g.m.a finished
23.August 2001: chrisanthemes finished
22.August 2001: Armin Egger plays
v.i.r.u.s
21.August 2001:
g.i.l.m.a.r.a.n.u.a pusplished
17.July 2001: t.o.b.a.la.t.i.n.o pusplished now
17. June 2001: v4m.net now open

02. June 2001: Gabriel Guillén
plays man.dra.gora and v.i.r.u.s in Belgrade
27. April 2001: Armin Egger winner of the special prize at the International Guitarfestival
16. April 2001: Compositions of J.P at the International Guitarfestival
10. April 2001: man.dra.gora published
8. April 2001: v.i.r.u.s published
22. January 200: toba.latina
28.December 2000: Space War!!!
11.November 2000:
v.i.r.u.s
17. October 2000: CD man.dra.gora published
11. October 2000: Jovan Pesec, Vice President & Art Director of International Guitar Festival
16. August 2000:
01.randin.ovir://mutuation.number.one
14
. July 2000: variations.on.the.hiv.virus
17. June 2000: v.i.r.u.s
16. June 2000: ginger.bread.man
22. Februar 2000:
man.dra.gora


a.b.a.l.a.d.o.r.a..finished

The composition 
a.b.a.l.a.d.o.r.a
 concerto.4.guitar.&.string.quartet

of Jovan Pesec is finished  now and will be published soon on http://www.v4m.net.

Today Jovan Pesec finished the design of a composition, which will be named "abaladora". It was ordered by Gabriel Guillén and the Paracelsus String Quartet.
It is based on two pieces of Francisco Tarréga, Danza mora and La Alborado.
The composition will have the first performance next year at the International Guitar Festival 2002 in Rust in March 2002 at the occasion of Tarregas 150th birthday.


co-operation.between.NTONYX.&.v4m

Jovan Pesec (v4m) and Alexej Ustinov (ntonyx) signed an agreement concerning the development of classical guitar soundfonts and GigaSampler sounds.for use in soundcards and samplers.
Therefore Gabriel Guillén recorded a Fleta® guitar and Jovan Pesec  recorded a Ramirez® guitar in v4m-studios in Vienna. And NTONYX under the management of Alexej Ustinov will produce the SoundFonts and the GIGs. Both guitars are of an extra qualtity, which is really difficult to hear at those days.
All the guitars in the GIGs will not be looped, because a live played guitar is not looped. The goal is the achieving of a quality of nylon string guitar sounds, which has never been heard before.

The name of the project is "Recuerdos de la Alhambra", and as soon as the project is finished, you will hear about it on this homepage.  


e.n.i.g.m.a..finished

The composition 
e.n.i.g.m.a
 morph.4.harps.exponent.7.on.enigma

of Jovan Pesec is published  now on http://www.v4m.net.

This music is based on 3 images of Judith.P.Fischer, which were shown in Vienna at the exhibition "sex sells" in September 2001.

More information here


chrisanthémes..finished

The composition 
chrisanthemes
 12.morphs.on.chrisanthemes.linear.scan
 12.morphs.on.chrisanthemes.banded.scan

of Jovan Pesec is published  now on http://www.v4m.net.

This music is based on the project "chrisanthémes" of Judith.P.Fischer, which were shown in Paris 1999 and in Vienna during summer 2001 at the "Künstlerhaus" 

More information here


armin.egger..plays.virus

Armin Egger (Austria) winner of the  prize of the jury for his interpretation of  v.i.r.u.s 01.radin.ovir://mutuation.number.one at the International Guitar Festival Rust 2001.plays this composition at the International Guitar Festival Wolfsberg 2001 on Saturday, 25. Aougust 2001 in Wolfsberg.

More information here


g.i.l.m.a.r.a.n.u.a..published

The composition 
g.i.l.m.a.r.a.n.u.a
 introduction.12.morphs.&.finale.on.una.lagrima.4.guitar.solo

of Jovan Pesec is published  now by future@vision4media.net.
The composition, a hommage on Francisco Tárrega is based on the famous tune "Una Lagrima", designed on the occassion of the 150th birthday of Tárrega,  is published under edition.pesec.

More information here


t.o.b.a.l.a.t.i.n.o..published..now

The composition 

  t.o.b.a.l.a.t.i.n.o  
six.dna.based.mutuations.4.guitar.trio

of Jovan Pesec is published  now by future@vision4media.net.
The composition was designed for the vienna guitar trio and is published under edition.guillen.


 

v4m.net.now.open

v4m.net is a platform for serveral kinds of art publishing, especially for classical guitar music.

All kind of downloads are completely free.

  For more informations click here.


 

gabriel.guillen.plays.man.dra.gora.and.virus

Gabriel Guillén plays "man.dra.gora" and "v.i.r.u.s" of Jovan Pesec on 9th June in Belgrade and on 10th June in Novi Sad.

He also leads a master class on 11th June in Belgrade at the Srednja Muzička Škola ”Isidor Bajic”.

For more informations click here.


 

armin.egger.winner.of.the.special.prize

Armin Egger (Austria) won the special prize of the jury for his interpretation of  v.i.r.u.s 01.radin.ovir://mutuation.number.one at the International Guitar Festival Rust 2001.

For more information, please refer to International Guitar Festival Rust 2001

 

compositions.of.JP.at.the.guitar.festival

Famous artists and students will play pieces from v.i.r.u.s at the International Guitar Festival Rust 2001.

Participants: 

01.radin.ovir://mutuation.number.one

Gabriel Guillén:

04.narid.rovi://mutuation.number.four

Students:

05.dinar.viro://mutuation.number.five

Vladislav Blaha:

06.nidar.rivo://mutuation.number.sex

For more information, please refer to International Guitar Festival Rust 2001

 

man.dra.gora.published

The composition 

man.dra.gora - romance.&.fantasy.4.guitar

of Jovan Pesec will be published  now.
Please order the composition under edition guillén,  number T6104 by

Joachim-Trekel-Musik-Verlag, Hamburg

trekel@tecs.de
http://www.trekel.de

 


 

virus.published

The composition 

v.i.r.u.s - s(e)x.mutuations.4.guitar

of Jovan Pesec will be published  now.
Please order the composition under edition guillén,  number T6106 by

Joachim-Trekel-Musik-Verlag, Hamburg

trekel@tecs.de
http://www.trekel.de

Many thanks to Gabriel Guillén and Vladislav Blaha for edited some viruses!


 

the.nicotants

A hudge series of genetic dances  based on the DNA sequence of nicotine, called the.nicotants (32.mutations) is finished. 
This compositions is also part of the project GIM and uses the fantasic CAM-program KoanPro 2.4 from SSEYO

For more information, please refer to the.nicotants.


 

radin.ovir.space.war

A new genetic dance  based on Karposis sarcoma associated human herpes virus was added to variations.on.hiv.virus
This dances  ar part of the project GIM and uses the fantasic program KoanPro.

For more information, please refer to variations.on.hiv.virus


 

v.i.r.u.s

Composition is finished and will be published by Musikverlag Trekel soon. 

For more information, please refer to v.i.r.u.s.


CD man.dra.gora published

Read, what Gabriel Guillén, premiere venezolan guitarrist is saying about man.dra.gora:

"The variation-wealth of this work is based on a versatile guitar-technique and requires new musical expression-forms again and again. This induced me to study man.dra.gora in the year 1999. I hope very much that the listener dunks (together with me) into this imaginative music-world and get the experience, how the statement and the expression of this music is changing permanently. Jovan Pesec, Austrian composer, let join us through man.dra.gora, a musical world-trip free from the borders, that put six strings on the guitar."

Gabriel Guillén, 11th October 2000

Please refer to Gabriel Guillén - Discography


 


 

International Guitar Festival

Jovan Pesec was apointed at 11.th of October 2000 at the board of the International Guitar Festival Rust.
His scope of duties as Vice President and Art Director are the support of the management in questions of art and business.

 


01.radin.ovir://mutuation.number.one

01.radin.ovir://mutuation.number.one is the strictly recommended master piece for the first round of the International Guitar Competition 2001 in Rust, Austria. 

For more information, please refer to v.i.r.u.s.


 

variations.on.the.hiv.virus

6 genetic dances  based on Karposis sarcoma associated human herpes virus finished! 
This dances  ar part of the project GIM.

For more information, please refer to variations.on.hiv.virus


v.i.r.u.s

The composition work for v.i.r.u.s has begun. (17.6.2000).
s(e)x.mutuations.based.on.DNA-substrings.of.HIV.

Short sample of a DNA-substring of the HIV-Virus and the graphical representation of his structure:

gatgatcattatcgttatagcaatcatcct gatcattttt atgctcagtcgccgcaccaa
taccatagcccaggcgccgg tgaagatgatctaccccgac gtagatcgcagggcacctcc
tagcggcggagccccaacac gggaggaaatcaaaaacatc ctgctgggaatgcaccagct
acaacaagaggagaggcaga aggcggatgatttgaaaaaa agtacaccctcggtgtttca
gcgtaccgcaaacggccttc gtcagcgtctgagaggatat aaacctctga ctcaatcgct  

  
01.radin.ovir://mutuation.number.one is the strictly recommended master piece for the first round of the International Guitar Competition 2001 in Rust, Austria. 
This whole edition is part of the GIM project

For more information, please refer to v.i.r.u.s.



ginger.bread.man

fractal.sonata.for.guitar finished at end of June 2000!
This sonata is part of the project FIM and dedicated to Gabriel Guilen.

For more information, please refer to ginger.bread.man.


man.dra.gora

Am Dienstag 22. Februar 2000 findet um 19.30 Uhr im 

ART CULT CENTER
AUSTRIA TABAK
A-1091 WIEN, Porzellangasse 51

im Rahmen der KONZERTSOIRÉE
Gitarrekonzert mit Gabriel Guillen

"Von Domenico Scarlatti (Italien) bis Jovan Pesec (Austria)"

statt.

Karten an der Abendkasse (ATS 120,-- Ermäßigt 80,--)

More information.


 

*contact Jovan Pesec.

 

Top of Page

 


 

a service of
CyberNetServe_s.gif (2985 Byte)
Stand: 22. Mai 2004

 


.